pias1

Ensembl ID:
ENSDARG00000036094
Human Orthologue:
PIAS1
Human Description:
protein inhibitor of activated STAT, 1 [Source:HGNC Symbol;Acc:2752]
Mouse Orthologue:
Pias1
Mouse Description:
protein inhibitor of activated STAT 1 Gene [Source:MGI Symbol;Acc:MGI:1913125]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa155 Nonsense Confirmed mutation in F2 line During 2018
sa20991 Nonsense Available for shipment Available now
sa1753 Essential Splice Site Available for shipment Available now
sa8701 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa155
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052397 Nonsense 21 653 2 15
Genomic Location (Zv9):
Chromosome 7 (position 35255843)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 33650183
GRCz11 7 33921333
KASP Assay ID:
554-0016.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCTTCTCCTGTATAGCAAATGGTGATGAGCCTGCGGGTGTCAGAGCTG[C/T]AGGTTCTCCTGGGCTACGCAGGCCGAAACAAACATGGACGAAAGCACGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20991
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052397 Nonsense 440 653 11 15
Genomic Location (Zv9):
Chromosome 7 (position 35224545)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 33618885
GRCz11 7 33890035
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTGCGTGTTTGTTTGTGTGTAATCAGGTGGGTGTCGTACAAGCGTGT[T/A]GGAGCAGAATTCTCAAACAAATGGCAGCAGTGGAGGAGGAAACAGAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1753
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052397 Essential Splice Site 535 653 13 15
Genomic Location (Zv9):
Chromosome 7 (position 35222387)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 33616727
GRCz11 7 33887877
KASP Assay ID:
554-1746.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGAYGTCCCACACCCCAATAGGCATCAATTCAAATTGAAATTTTTACTT[A/G]GTTCCAGCTCAAGCTAGAAAATCAAATTAAAATGTAGCTTTATTTTTTNC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8701
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052397 Essential Splice Site 535 653 13 15
Genomic Location (Zv9):
Chromosome 7 (position 35222386)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 33616726
GRCz11 7 33887876
KASP Assay ID:
2259-9095.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAYGTCCCACACCCCAATAGGCATCAATTCAAATTGAAATTTTTACTTR[G/A]TTCCAGCTCAAGCTAGAAAATCAAATTAAAATGTAGCTTTATTTTTTNCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Major depressive disorder: Common genetic variation and antidepressant efficacy in major depressive disorder: a meta-analysis of three genome-wide pharmacogenetic studies. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link