
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
itga11a
- Ensembl ID:
- ENSDARG00000036086
- ZFIN ID:
- ZDB-GENE-050324-1
- Description:
- integrin, alpha 11a [Source:RefSeq peptide;Acc:NP_001166098]
- Human Orthologue:
- ITGA11
- Human Description:
- integrin, alpha 11 [Source:HGNC Symbol;Acc:6136]
- Mouse Orthologue:
- Itga11
- Mouse Description:
- integrin alpha 11 Gene [Source:MGI Symbol;Acc:MGI:2442114]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa13635 | Nonsense | Available for shipment | Available now |
sa9327 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa18873 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa13635
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000052389 | Nonsense | 454 | 1228 | 11 | 30 |
ENSDART00000127081 | Nonsense | 416 | 1190 | 11 | 30 |
- Genomic Location (Zv9):
- Chromosome 7 (position 34542221)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 32936561 GRCz11 7 33207711 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TAAAGGAGACTCGGCAAGGGAAAGTGGKTCCACCGAAWTCCTCCTATGAA[C/T]AAGAGTTCCCAGAAGAACTAAAGAACCATGGAGCCTACCTGGGTAAAAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9327
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000052389 | Essential Splice Site | 972 | 1228 | 23 | 30 |
ENSDART00000127081 | Essential Splice Site | 934 | 1190 | 23 | 30 |
ENSDART00000052389 | Essential Splice Site | 972 | 1228 | 23 | 30 |
ENSDART00000127081 | Essential Splice Site | 934 | 1190 | 23 | 30 |
- Genomic Location (Zv9):
- Chromosome 7 (position 34523342)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 32917682 GRCz11 7 33188832 - KASP Assay ID:
- 554-6136.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GGTGAGTGYAAAAGCCTGTGAGGTTTCTCATRTTGTTGTCRTGTGTCTGC[A/C]GTGAAGGAGAAGAAGTCATCCTCTATGAYAACTCCAATGAAATTTTCTAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa18873
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000052389 | Essential Splice Site | 972 | 1228 | 23 | 30 |
ENSDART00000127081 | Essential Splice Site | 934 | 1190 | 23 | 30 |
ENSDART00000052389 | Essential Splice Site | 972 | 1228 | 23 | 30 |
ENSDART00000127081 | Essential Splice Site | 934 | 1190 | 23 | 30 |
- Genomic Location (Zv9):
- Chromosome 7 (position 34523342)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 32917682 GRCz11 7 33188832 - KASP Assay ID:
- 554-6136.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGTGAGTGTAAAAGCCTGTGAGGTTTCTCATATTGTTGTCATGTGTCTGC[A/C]GTGAAGGAGAAGAAGTCATCCTCTATGATAACTCCAATGAAATTTTCTAC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Attention deficit hyperactivity disorder: Molecular genetics of adult ADHD: converging evidence from genome-wide association and extended pedigree linkage studies. (View Study)
- Major depressive disorder: Common genetic variation and antidepressant efficacy in major depressive disorder: a meta-analysis of three genome-wide pharmacogenetic studies. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: