tph1b

Ensembl ID:
ENSDARG00000036082
ZFIN ID:
ZDB-GENE-030805-6
Description:
tryptophan hydroxylase 1b [Source:RefSeq peptide;Acc:NP_001001843]
Human Orthologue:
TPH1
Human Description:
tryptophan hydroxylase 1 [Source:HGNC Symbol;Acc:12008]
Mouse Orthologue:
Tph1
Mouse Description:
tryptophan hydroxylase 1 Gene [Source:MGI Symbol;Acc:MGI:98796]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa26987 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa26987
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052385 Essential Splice Site 259 480 7 11
Genomic Location (Zv9):
Chromosome 7 (position 34446223)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 32840563
GRCz11 7 33111713
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTGTCGCCAGCAGAGGACAGTAGTTGCACGAATGTTTTTATGTGTTTC[A/T]GAGAGAACCGGCTTCACCATTCGGCCTGTTGCTGGCTATCTGTCACCCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link