zgc:103601

Ensembl ID:
ENSDARG00000036068
ZFIN ID:
ZDB-GENE-041010-49
Description:
hypothetical protein LOC449801 [Source:RefSeq peptide;Acc:NP_001005974]
Human Orthologues:
NAT1, NAT2
Human Descriptions:
N-acetyltransferase 1 (arylamine N-acetyltransferase) [Source:HGNC Symbol;Acc:7645]
N-acetyltransferase 2 (arylamine N-acetyltransferase) [Source:HGNC Symbol;Acc:7646]
Mouse Orthologues:
Nat1, Nat2, Nat3
Mouse Descriptions:
N-acetyl transferase 1 Gene [Source:MGI Symbol;Acc:MGI:97279]
N-acetyltransferase 2 (arylamine N-acetyltransferase) Gene [Source:MGI Symbol;Acc:MGI:109201]
N-acetyltransferase 3 Gene [Source:MGI Symbol;Acc:MGI:102537]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9183 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa9183
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052357 Nonsense 220 288 2 2
Genomic Location (Zv9):
Chromosome 7 (position 39586604)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 37923244
GRCz11 7 38194502
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGATGTCGGTTATGCTGCAGACTAAWCCAGACTCTCTYTTCCTGCTC[A/T]AGACCATTTGCTCCCTTCAGACGGTCACTGGCTACAGAGCTCTGCTCGGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link