zgc:153790

Ensembl ID:
ENSDARG00000036059
ZFIN ID:
ZDB-GENE-061013-104
Description:
Transmembrane protein with metallophosphoesterase domain [Source:UniProtKB/Swiss-Prot;Acc:Q08BG1]
Human Orthologue:
TMPPE
Human Description:
transmembrane protein with metallophosphoesterase domain [Source:HGNC Symbol;Acc:33865]
Mouse Orthologue:
Glb1
Mouse Description:
galactosidase, beta 1 Gene [Source:MGI Symbol;Acc:MGI:88151]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10390 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10390
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052347 Essential Splice Site 235 437 1 5
ENSDART00000138065 Essential Splice Site 239 441 1 5
Genomic Location (Zv9):
Chromosome 7 (position 30490603)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 28882945
GRCz11 7 29154095
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGCTCCAAACTGCAGCGCATTGTGTCTATGGTGAATGAGCTCAACCCAG[G/A]TAATWATGTCTCATTATAGGCTTAACTATCAGTGTTTTGATGTGTTAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link