
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
gnao1b
- Ensembl ID:
- ENSDARG00000036058
- ZFIN ID:
- ZDB-GENE-040426-1693
- Description:
- guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O, b [Source:
- Human Orthologue:
- GNAO1
- Human Description:
- guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O [Source:HGNC
- Mouse Orthologue:
- Gnao1
- Mouse Description:
- guanine nucleotide binding protein, alpha O Gene [Source:MGI Symbol;Acc:MGI:95775]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa44665 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa20958 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa44665
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000052346 | Nonsense | 5 | 354 | 1 | 8 |
- Genomic Location (Zv9):
- Chromosome 7 (position 30470103)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 28862445 GRCz11 7 29133595 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GATACAGCTGTCGCGCGTCCCGACTCTCGGTCTTGCAATGGGATGCACGT[T/A]AAGTGCAGAGGAGCGCGCGGCTCTGGATCGCAGCAGAGCCATCGAGAAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa20958
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000052346 | Nonsense | 231 | 354 | 6 | 8 |
- Genomic Location (Zv9):
- Chromosome 7 (position 30477044)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 28869386 GRCz11 7 29140536 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGCTTTGAGGATGTGACAGCCATTATCTTCTGTGTGGCAATGAGCGGATA[C/A]GACCAAATGCTCCATGAAGATGAGACCACGGTGAAAACTACCACTCTCTA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: