zgc:101549

Ensembl ID:
ENSDARG00000036009
ZFIN ID:
ZDB-GENE-041114-125
Description:
hypothetical protein LOC492779 [Source:RefSeq peptide;Acc:NP_001007421]
Human Orthologue:
NANS
Human Description:
N-acetylneuraminic acid synthase [Source:HGNC Symbol;Acc:19237]
Mouse Orthologue:
Nans
Mouse Description:
N-acetylneuraminic acid synthase (sialic acid synthase) Gene [Source:MGI Symbol;Acc:MGI:2149820]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13915 Nonsense Available for shipment Available now
sa11525 Nonsense Available for shipment Available now
sa24598 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa13915
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054817 Nonsense 82 352 2 6
Genomic Location (Zv9):
Chromosome 25 (position 5631115)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 5165672
GRCz11 25 5292209
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
WCGCTCTGGATCGGCTTTACACATCCCCTCACGCTTGGGGCCCGACATAC[G/T]GAGCTCRTAAGCACCATCTRGAGTTCAGTCACGAGCAGTACAGAGAACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11525
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054817 Nonsense 278 352 5 6
Genomic Location (Zv9):
Chromosome 25 (position 5635606)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 5168830
GRCz11 25 5296700
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTGGTGAAAGCCATCCGGGCGGTGGAGATGGCCATGGGGTCACCAGTC[A/T]AACAGATGCTGCCCTGTGAGGCTTCATGCCACRGCAAGGTCACATTTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24598
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054817 Nonsense 339 352 6 6
Genomic Location (Zv9):
Chromosome 25 (position 5638315)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 5171539
GRCz11 25 5299409
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGACCAGAGAACATCTTCAAACTGGTTGGCAAGAAAATATCTGTGAACT[T/A]GGAGAAAGATGCCACAATTACTGATGCCATGATTAAAGGTTGATGATTAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link