
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zfpm2b
- Ensembl ID:
- ENSDARG00000035997
- ZFIN ID:
- ZDB-GENE-060130-5
- Description:
- zinc finger protein, multitype 2b [Source:RefSeq peptide;Acc:NP_001034613]
- Human Orthologue:
- ZFPM2
- Human Description:
- zinc finger protein, multitype 2 [Source:HGNC Symbol;Acc:16700]
- Mouse Orthologue:
- Zfpm2
- Mouse Description:
- zinc finger protein, multitype 2 Gene [Source:MGI Symbol;Acc:MGI:1334444]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa23488 | Nonsense | Available for shipment | Available now |
sa30710 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa23488
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000052260 | Nonsense | 320 | 1093 | 8 | 8 |
ENSDART00000103745 | Nonsense | 245 | 1018 | 7 | 7 |
ENSDART00000145202 | Nonsense | 221 | 994 | 5 | 5 |
- Genomic Location (Zv9):
- Chromosome 19 (position 17378517)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 13278146 GRCz11 19 13196612 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGTGCATTATGATGTTCACTAATACCATTCTTTTTTTATTTTAAGGTCTC[A/T]AGTCTGATGAGGTGTCCACTGGAAGTAACTTGAAATGCACCATTTGCGAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa30710
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000052260 | Nonsense | 961 | 1093 | 8 | 8 |
ENSDART00000103745 | Nonsense | 886 | 1018 | 7 | 7 |
ENSDART00000145202 | Nonsense | 862 | 994 | 5 | 5 |
- Genomic Location (Zv9):
- Chromosome 19 (position 17380440)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 13276223 GRCz11 19 13194689 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AACCCACCGATTATGCTACAGGGATGCTGGTCTCACAAAGTGAAAGGAGA[C/T]AGAGTCCAAACGAGGGCAGTGAGGGAGAAAAAGATCAGCCAATGCCTGAC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Autism spectrum disorder, attention deficit-hyperactivity disorder, bipolar disorder, major depressive disorder, and schizophrenia (combined): Identification of risk loci with shared effects on five major psychiatric disorders: a genome-wide analysis. (View Study)
- Glaucoma (primary open-angle): Common variants at 9p21 and 8q22 are associated with increased susceptibility to optic nerve degeneration in glaucoma. (View Study)
- Platelet counts: New gene functions in megakaryopoiesis and platelet formation. (View Study)
- Sudden cardiac arrest: GWAS for discovery and replication of genetic loci associated with sudden cardiac arrest in patients with coronary artery disease. (View Study)
- Vascular endothelial growth factor levels: Identification of cis- and trans-acting genetic variants explaining up to half the variation in circulating vascular endothelial growth factor levels. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: