zfpm2b

Ensembl ID:
ENSDARG00000035997
ZFIN ID:
ZDB-GENE-060130-5
Description:
zinc finger protein, multitype 2b [Source:RefSeq peptide;Acc:NP_001034613]
Human Orthologue:
ZFPM2
Human Description:
zinc finger protein, multitype 2 [Source:HGNC Symbol;Acc:16700]
Mouse Orthologue:
Zfpm2
Mouse Description:
zinc finger protein, multitype 2 Gene [Source:MGI Symbol;Acc:MGI:1334444]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23488 Nonsense Available for shipment Available now
sa30710 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa23488
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052260 Nonsense 320 1093 8 8
ENSDART00000103745 Nonsense 245 1018 7 7
ENSDART00000145202 Nonsense 221 994 5 5
Genomic Location (Zv9):
Chromosome 19 (position 17378517)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 13278146
GRCz11 19 13196612
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGCATTATGATGTTCACTAATACCATTCTTTTTTTATTTTAAGGTCTC[A/T]AGTCTGATGAGGTGTCCACTGGAAGTAACTTGAAATGCACCATTTGCGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30710
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052260 Nonsense 961 1093 8 8
ENSDART00000103745 Nonsense 886 1018 7 7
ENSDART00000145202 Nonsense 862 994 5 5
Genomic Location (Zv9):
Chromosome 19 (position 17380440)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 13276223
GRCz11 19 13194689
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCCACCGATTATGCTACAGGGATGCTGGTCTCACAAAGTGAAAGGAGA[C/T]AGAGTCCAAACGAGGGCAGTGAGGGAGAAAAAGATCAGCCAATGCCTGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link