
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:114147
- Ensembl ID:
- ENSDARG00000035949
- ZFIN ID:
- ZDB-GENE-050913-37
- Description:
- Transmembrane protein 106B [Source:UniProtKB/Swiss-Prot;Acc:Q1LWC2]
- Human Orthologue:
- TMEM106B
- Human Description:
- transmembrane protein 106B [Source:HGNC Symbol;Acc:22407]
- Mouse Orthologue:
- Tmem106b
- Mouse Description:
- transmembrane protein 106B Gene [Source:MGI Symbol;Acc:MGI:1919150]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa36865 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa36865
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000052140 | Nonsense | 27 | 267 | 1 | 7 |
ENSDART00000137292 | Nonsense | 27 | 267 | 2 | 8 |
- Genomic Location (Zv9):
- Chromosome 19 (position 32644446)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 31811735 GRCz11 19 31399048 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CATACCTGTCACGATGAGTGTCAGGACAGCCTGACCTCGTCCCCGGGTTA[C/A]AGTGCCATGCAGACCGATGACAGCAAGAGTGGCGGAGACGTGTCTCAGTT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Response to amphetamines: Genome-wide association study of d-amphetamine response in healthy volunteers identifies putative associations, including cadherin 13 (CDH13). (View Study)
- Response to taxane treatment (placlitaxel): Genetic association with overall survival of taxane-treated lung cancer patients - A genome-wide association study in human lymphoblastoid cell lines followed by a clinical association study. (View Study)
- Tourette syndrome: Genome-wide association study of Tourette's syndrome. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: