
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
bzw2
- Ensembl ID:
- ENSDARG00000035918
- ZFIN ID:
- ZDB-GENE-040426-746
- Description:
- Basic leucine zipper and W2 domain-containing protein 2 [Source:UniProtKB/Swiss-Prot;Acc:Q1LUC1]
- Human Orthologue:
- BZW2
- Human Description:
- basic leucine zipper and W2 domains 2 [Source:HGNC Symbol;Acc:18808]
- Mouse Orthologue:
- Bzw2
- Mouse Description:
- basic leucine zipper and W2 domains 2 Gene [Source:MGI Symbol;Acc:MGI:1914162]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa43304 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa13934 | Essential Splice Site | Available for shipment | Available now |
sa39251 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa43304
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000052134 | Nonsense | 66 | 421 | 2 | 11 |
ENSDART00000133101 | Nonsense | 66 | 273 | 3 | 8 |
ENSDART00000136213 | Nonsense | 66 | 421 | 4 | 13 |
ENSDART00000144337 | Nonsense | 66 | 116 | 5 | 6 |
ENSDART00000147504 | Nonsense | 66 | 203 | 3 | 7 |
- Genomic Location (Zv9):
- Chromosome 19 (position 32274332)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 31441621 GRCz11 19 31028934 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTAGCCAAATTTCTGGATGTCACTGGGTCGAGACTAGACTACCGTCGCTA[T/A]GCCGACACCCTGTTTGACATCCTCATTGCTGGGAGCATGCTGGGTGAGAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa13934
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000052134 | Essential Splice Site | 182 | 421 | 5 | 11 |
ENSDART00000133101 | Essential Splice Site | 182 | 273 | 6 | 8 |
ENSDART00000136213 | Essential Splice Site | 182 | 421 | 7 | 13 |
ENSDART00000144337 | None | 116 | None | 6 | |
ENSDART00000147504 | Essential Splice Site | 182 | 203 | 6 | 7 |
- Genomic Location (Zv9):
- Chromosome 19 (position 32264848)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 31432137 GRCz11 19 31019450 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GCCACCACCAATCCTCACCAGCCTCTTTAGCGATAATCTTGTCAAAGAAG[G/A]TTTGTGTGATCTTTRTGAGGACTTTTTTTGCATRTTACTATTTAGGGCAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa39251
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000052134 | Nonsense | 371 | 421 | 9 | 11 |
ENSDART00000133101 | None | 273 | None | 8 | |
ENSDART00000136213 | Nonsense | 371 | 421 | 11 | 13 |
ENSDART00000144337 | None | 116 | None | 6 | |
ENSDART00000147504 | None | 203 | None | 7 |
- Genomic Location (Zv9):
- Chromosome 19 (position 32258225)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 31425514 GRCz11 19 31012827 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATAACATCCACTTCATGAAGTCCTTCTCCAAAATAGTGGTGCTCTTCTAC[A/T]AAGGTATGCCATCTCCCACCTGATCAGTGCTTTTAATGATATCTTAGAGG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Alzheimer's disease (cognitive decline): Genome-wide association study of the rate of cognitive decline in Alzheimer's disease. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: