zgc:113026

Ensembl ID:
ENSDARG00000035910
ZFIN ID:
ZDB-GENE-050220-1
Description:
zinc finger protein 281-like [Source:RefSeq peptide;Acc:NP_001012505]
Human Orthologue:
ZNF281
Human Description:
zinc finger protein 281 [Source:HGNC Symbol;Acc:13075]
Mouse Orthologue:
Zfp281
Mouse Description:
zinc finger protein 281 Gene [Source:MGI Symbol;Acc:MGI:3029290]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30958 Nonsense Mutation detected in F1 DNA During 2018
sa8722 Nonsense Mutation detected in F1 DNA During 2018
sa17826 Essential Splice Site Available for shipment Available now
sa10191 Nonsense Available for shipment Available now
sa10475 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa30958
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052127 Nonsense 15 809 2 7
ENSDART00000123020 Nonsense 32 826 1 6
ENSDART00000141898 Nonsense 32 826 2 7
Genomic Location (Zv9):
Chromosome 12 (position 17161229)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 16040939
GRCz11 12 16089749
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGAGGCATGGACCCCAACTATACCCCAAGCATGATCATGTTCAGCCATT[T/A]ACCTCCAGTGACCAGCTTCACGCGCTTAACTTCACAGACCTCTATGGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8722
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052127 Nonsense 24 809 2 7
ENSDART00000123020 Nonsense 41 826 1 6
ENSDART00000141898 Nonsense 41 826 2 7
Genomic Location (Zv9):
Chromosome 12 (position 17161256)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 16040966
GRCz11 12 16089776
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCATGATCATGTTCAGCCATTTACCTCCAGTGACCAGCTTCRCGCGCT[T/G]AACTTCACAGACCTCTATGGCAGATTTGCCCCAGGAGATGATCCTGAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17826
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052127 Essential Splice Site 107 809 2 7
ENSDART00000123020 Essential Splice Site 124 826 1 6
ENSDART00000141898 Essential Splice Site 124 826 2 7
Genomic Location (Zv9):
Chromosome 12 (position 17161507)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 16041217
GRCz11 12 16090027
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTTGGCAACCACCAAAATATGCTTTTGCATGACCTAAGCCTTAGCAAC[G/A]TAAGTGAACATGAAGGATGGATGAGTTATCATTGAATGTTGTYCTCAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10191
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052127 Nonsense 197 809 5 7
ENSDART00000123020 Nonsense 214 826 4 6
ENSDART00000141898 Nonsense 214 826 5 7
Genomic Location (Zv9):
Chromosome 12 (position 17165256)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 16044966
GRCz11 12 16093776
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATTTGCTTTTTATTGTACAGGTGAGAGGCCTTTCAGGTGCAGTCAGTG[T/A]AAWATGAGCTTCATACAGAAGTATCTACTGCAACGGCACGAGAAAATCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10475
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052127 Nonsense 754 809 7 7
ENSDART00000123020 Nonsense 771 826 6 6
ENSDART00000141898 Nonsense 771 826 7 7
Genomic Location (Zv9):
Chromosome 12 (position 17171696)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 16051406
GRCz11 12 16100216
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATAGAGAATTTCGCCCAAGCCTTCGGCTCACAGTTCAAGTCTGGTCGG[C/T]GAACTCCGCTAGGTTACGGCGGCGACCCACGAGTAGGTGTTGTTGAGGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link