slc25a44b

Ensembl ID:
ENSDARG00000035905
ZFIN ID:
ZDB-GENE-050320-89
Description:
solute carrier family 25, member 44 b [Source:RefSeq peptide;Acc:NP_001013537]
Human Orthologue:
SLC25A44
Human Description:
solute carrier family 25, member 44 [Source:HGNC Symbol;Acc:29036]
Mouse Orthologue:
Slc25a44
Mouse Description:
solute carrier family 25, member 44 Gene [Source:MGI Symbol;Acc:MGI:2444391]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40995 Nonsense Mutation detected in F1 DNA During 2018
sa34167 Nonsense Mutation detected in F1 DNA During 2018
sa14027 Nonsense Available for shipment Available now
sa18105 Nonsense Available for shipment Available now
sa17175 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa40995
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052123 Nonsense 12 316 2 4
ENSDART00000125113 Nonsense 12 316 1 3
Genomic Location (Zv9):
Chromosome 7 (position 49757234)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 48027470
GRCz11 7 48300246
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTACAGGCAGGAAACATGCAGCAGAAGCGCAACATTCAGATTATAGAATG[G/A]GAGGACTTGGACAAACGCAAGTTCTACTCCTTTGGACTGTTCATGACCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34167
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052123 Nonsense 44 316 2 4
ENSDART00000125113 Nonsense 44 316 1 3
Genomic Location (Zv9):
Chromosome 7 (position 49757328)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 48027564
GRCz11 7 48300340
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACCATGACCATCCGTGCCACGGTCTACCCAGCCACGCTAATCCGCACC[A/T]GACTGCAGGTTCAGAAGGGGAAATCTCTCTACACTGGGACCTACGACGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14027
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052123 Nonsense 94 316 2 4
ENSDART00000125113 Nonsense 94 316 1 3
Genomic Location (Zv9):
Chromosome 7 (position 49757480)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 48027716
GRCz11 7 48300492
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGTGACCACGTTCACACTCATATCAGGGCAGGCGTACATAACCACTTA[T/A]GAATTGGTAAGAAAATATGTCTCCAGCTACTCTAAAGACAATACGCTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18105
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052123 Nonsense 167 316 2 4
ENSDART00000125113 Nonsense 167 316 1 3
Genomic Location (Zv9):
Chromosome 7 (position 49757697)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 48027933
GRCz11 7 48300709
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTTAAACCCAAAACACCATCGGGAGCAAAGCACTCTGTGTTTTTCGGC[C/T]AGACAAGAGACATTATTGGGCAGATATTTGCAGCAGATGGCATWCGTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17175
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052123 Essential Splice Site 210 316 2 4
ENSDART00000125113 Essential Splice Site 210 316 1 3
Genomic Location (Zv9):
Chromosome 7 (position 49757830)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 48028066
GRCz11 7 48300842
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAYATCCCCAACAGTGCTGTTTGGTGGCCCTTTTACCACTTCTATGCAG[G/C]TGAGRGATGCAGTAAYAATCTTTTTTTTTTTTTTTTAATTATCATACAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link