si:dkey-264p5.1

Ensembl ID:
ENSDARG00000035895
ZFIN ID:
ZDB-GENE-060503-916
Description:
Fibronectin type III domain-containing protein 5 [Source:UniProtKB/Swiss-Prot;Acc:Q1L867]
Human Orthologue:
FNDC5
Human Description:
fibronectin type III domain containing 5 [Source:HGNC Symbol;Acc:20240]
Mouse Orthologue:
Fndc5
Mouse Description:
fibronectin type III domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:1917614]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45676 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45676
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052108   111 207 3 5
ENSDART00000074497 Essential Splice Site 30 125 None 7
ENSDART00000114442   111 207 3 6
Genomic Location (Zv9):
Chromosome 19 (position 29893560)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 29823582
GRCz11 19 29410805
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTACATTGTCCATGTTCAGTCCATTAGCATGAGCGGCACCAGTCCTCC[A/G]AGTGAACCTGTCCTGTTCCGCACACCCAAAGAGTCAGAGAAACTGGCCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link