zgc:101116

Ensembl ID:
ENSDARG00000035879
ZFIN ID:
ZDB-GENE-040801-78
Description:
fucosidase, alpha-L-1, tissue [Source:RefSeq peptide;Acc:NP_001003559]
Human Orthologue:
FUCA1
Human Description:
fucosidase, alpha-L- 1, tissue [Source:HGNC Symbol;Acc:4006]
Mouse Orthologue:
Fuca1
Mouse Description:
fucosidase, alpha-L- 1, tissue Gene [Source:MGI Symbol;Acc:MGI:95593]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18216 Nonsense Available for shipment Available now
sa23558 Essential Splice Site Available for shipment Available now
sa29230 Essential Splice Site Mutation detected in F1 DNA During 2018
sa15377 Nonsense Available for shipment Available now
sa43309 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa18216
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052090 Nonsense 113 451 1 8
Genomic Location (Zv9):
Chromosome 19 (position 33868820)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 32906236
GRCz11 19 32493356
KASP Assay ID:
2261-3481.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGATTTCCACGCGCAGTTTTTTGACCCTGATGCTTGGGCTGAGATCTTY[G/T]AAGCTTCCGGAGCAAAGTATGKAGGCTAYTGCTGCTTTTGCTTTGCCTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23558
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052090 Essential Splice Site 311 451 5 8
Genomic Location (Zv9):
Chromosome 19 (position 33865265)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 32902681
GRCz11 19 32489801
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGAAATATGAAGCTGAGTGAGCTGATGGATCTGCCAGCGCTTATAAAG[G/A]TGAGATGTGATGAGAATGTTCAGGCATTATACAATGTATCAAGTGCATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29230
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052090 Essential Splice Site 408 451 7 8
Genomic Location (Zv9):
Chromosome 19 (position 33864498)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 32901914
GRCz11 19 32489034
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCAGAACACCTTTGAACTTTCTGCACCCAAAACCTCGGACAACACAGTG[G/A]TAAATAAAATATGGAATGTAAAAAGTAAATTTTTCTTTTGTTAAGATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15377
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052090 Nonsense 412 451 8 8
Genomic Location (Zv9):
Chromosome 19 (position 33864401)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 32901817
GRCz11 19 32488937
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTAATTAGTGTCTTTGTTTCTCTTGCATCTGTGTTCAGGTGACTTTGT[T/A]GGGGAATYCTAAACCTTTGAAATGGGCTCCTCTGYATTCATCGGGACTRA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43309
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052090 Nonsense 426 451 8 8
Genomic Location (Zv9):
Chromosome 19 (position 33864359)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 32901775
GRCz11 19 32488895
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTTTGTTGGGGAATCCTAAACCTTTGAAATGGGCTCCTCTGCATTCAT[C/A]GGGACTGATTTTGTTGCTGCCTGATCTGCCTTTCTCACCCGCACAGGCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link