azin1b

Ensembl ID:
ENSDARG00000035869
ZFIN ID:
ZDB-GENE-030121-1
Description:
antizyme inhibitor 1 [Source:RefSeq peptide;Acc:NP_001007160]
Human Orthologue:
AZIN1
Human Description:
antizyme inhibitor 1 [Source:HGNC Symbol;Acc:16432]
Mouse Orthologue:
Azin1
Mouse Description:
antizyme inhibitor 1 Gene [Source:MGI Symbol;Acc:MGI:1859169]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa29231 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa29231
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052079 Essential Splice Site 92 436 2 10
ENSDART00000137611 Essential Splice Site 92 436 4 12
ENSDART00000144721   None 231 None 6
Genomic Location (Zv9):
Chromosome 19 (position 34315106)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 33352522
GRCz11 19 32939642
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTGAGCTCCTGTCTGCACTTGGTGTGGGATTTGTCTGTGCAAATAAGG[T/A]AGCTTTTTATTTTATTCCTATTTAAAGCTATTAGACGGCTTTTGAAATAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link