zgc:153436

Ensembl ID:
ENSDARG00000035868
ZFIN ID:
ZDB-GENE-061013-119
Description:
Protein spire homolog 1 [Source:UniProtKB/Swiss-Prot;Acc:Q1LYM3]
Human Orthologue:
SPIRE1
Human Description:
spire homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:30622]
Mouse Orthologue:
Spire1
Mouse Description:
spire homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1915416]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43310 Nonsense Mutation detected in F1 DNA During 2018
sa36872 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43310
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078066 Nonsense 426 761 10 18
Genomic Location (Zv9):
Chromosome 19 (position 34430139)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 33467555
GRCz11 19 33054675
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAAGTTGGCCATCAGCACACTATCTCTGGCTAACGGCACGTCACCGGCT[C/T]GAAGTCCTGTGAACGGTGTAGCCGGAGGGCATTCACTGTCCCAGAGGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36872
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078066 Essential Splice Site 679 761 17 18
Genomic Location (Zv9):
Chromosome 19 (position 34442328)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 33479744
GRCz11 19 33066864
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTCCACATCCAGCCACAAGAAAAACAGCCTTCAGCGCTCATTGTCTAG[G/A]TGTGTTTTAAAATACTACCAGTTAATATAAACCTGTGTATATATACACTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link