si:rp71-39b20.4

Ensembl ID:
ENSDARG00000035861
ZFIN ID:
ZDB-GENE-070912-704
Description:
Novel protein similar to vertebrate potassium channel, subfamily V, member 2 (KCNV2) [Source:UniProt
Human Orthologue:
KCNV2
Human Description:
potassium channel, subfamily V, member 2 [Source:HGNC Symbol;Acc:19698]
Mouse Orthologue:
Kcnv2
Mouse Description:
potassium channel, subfamily V, member 2 Gene [Source:MGI Symbol;Acc:MGI:2670981]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10587 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10587
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052065 Nonsense 483 539 2 2
ENSDART00000141475 Nonsense 423 468 2 2
Genomic Location (Zv9):
Chromosome 2 (position 23366495)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24842000
GRCz11 2 24497651
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCTTTTGGTATCATTTTAAATGGAATGCCAATCTCCATCCTGTTCAAC[A/T]AATTTTCTGACTATTAYGCCAAGCTAAAGGCTCAGGAGTGCACAAACACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link