zgc:101658

Ensembl ID:
ENSDARG00000035853
ZFIN ID:
ZDB-GENE-041010-188
Description:
CDKN2A-interacting protein [Source:RefSeq peptide;Acc:NP_001006085]
Human Orthologue:
CDKN2AIP
Human Description:
CDKN2A interacting protein [Source:HGNC Symbol;Acc:24325]
Mouse Orthologue:
Cdkn2aip
Mouse Description:
CDKN2A interacting protein Gene [Source:MGI Symbol;Acc:MGI:1918175]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21081 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21081
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052030 Nonsense 217 312 4 4
Genomic Location (Zv9):
Chromosome 7 (position 54416621)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 52686612
GRCz11 7 52957737
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGCGTGGAGTCCTGCAAAGCCAGTCTCACCTGTGTGTTTGTTCCTCTT[A/T]AAGACATTCCTGACTTGCCAGCAGGACGAACACAGAGAGAAGGCCAGGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link