zgc:153595

Ensembl ID:
ENSDARG00000035837
ZFIN ID:
ZDB-GENE-060929-1030
Description:
Uncharacterized protein C16orf52 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q0D289]
Mouse Orthologue:
BC030336
Mouse Description:
cDNA sequence BC030336 Gene [Source:MGI Symbol;Acc:MGI:2446240]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22045 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22045
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052004 Nonsense 127 167 3 3
Genomic Location (Zv9):
Chromosome 12 (position 11492048)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 10375119
GRCz11 12 10412962
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGCATGGCCGCTCTCATATTTCCAGTTGGGTTTTATATCAATCAAGTT[G/T]GAGGACAACCTTACAAATTACCCAATAATACTGTTGTTGGGTCCTCATAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link