sirt3

Ensembl ID:
ENSDARG00000035819
ZFIN ID:
ZDB-GENE-070112-1762
Description:
sirtuin 3 [Source:RefSeq peptide;Acc:NP_001073643]
Human Orthologue:
SIRT3
Human Description:
sirtuin 3 [Source:HGNC Symbol;Acc:14931]
Mouse Orthologue:
Sirt3
Mouse Description:
sirtuin 3 (silent mating type information regulation 2, homolog) 3 (S. cerevisiae) Gene [Source:MGI

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21101 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21101
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051973 Nonsense 97 357 3 8
ENSDART00000147036   None 252 3 8

The following transcripts of ENSDARG00000035819 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 58749854)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 57202463
GRCz11 7 57504903
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGACAATGTTCACCAGCAAACCCTTGAAGACATTGCAGAAAAAATCAGA[G/T]AACGCAAGTTTAAACGAATTGTGGTGATGGCAGGGGCAGGCATCAGCACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Uterine fibroids: A genome-wide association study identifies three loci associated with susceptibility to uterine fibroids. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link