zgc:153764

Ensembl ID:
ENSDARG00000035808
ZFIN ID:
ZDB-GENE-061013-353
Description:
H(+)/Cl(-) exchange transporter 4 [Source:RefSeq peptide;Acc:NP_001070786]
Human Orthologue:
CLCN4
Human Description:
chloride channel 4 [Source:HGNC Symbol;Acc:2022]
Mouse Orthologue:
Clcn4-2
Mouse Description:
chloride channel 4-2 Gene [Source:MGI Symbol;Acc:MGI:104571]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41920 Nonsense Mutation detected in F1 DNA During 2018
sa41919 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41920
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047126 Nonsense 36 768 2 12
Genomic Location (Zv9):
Chromosome 11 (position 45256839)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 43859106
GRCz11 11 44161498
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGAACCTGATGGACTTCTTAGATGAACCATTTCCAGATGTTGGCACTTA[T/A]GAGGACTTTCACACCATCGACTGGCTCCGAGAGAAGTCCAAAGACACAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41919
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047126 Nonsense 652 768 10 12
Genomic Location (Zv9):
Chromosome 11 (position 45244019)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 43846286
GRCz11 11 44148314
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACACACCGACTACAACGGCTTCCCGGTGGTGGTGTCCCGCGAGTCTGAG[C/T]GACTCATCGGCTTCGTGCAGAGACGAGACCTGATCCTGGCTATCAGTATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link