
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:busm1-71b9.3
- Ensembl ID:
- ENSDARG00000035791
- ZFIN ID:
- ZDB-GENE-041001-54
- Description:
- Si:busm1-71b9.3 protein [Source:UniProtKB/TrEMBL;Acc:Q3B7G9]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa1028 | Nonsense | F2 line generated | During 2018 |
Mutation Details
- Allele Name:
- sa1028
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000043087 | Nonsense | 51 | 453 | 2 | 9 |
- Genomic Location (Zv9):
- Chromosome 7 (position 56153062)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 52901448 GRCz11 7 53171100 - KASP Assay ID:
- 554-0932.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGGTTTTTAAAGTCCACAAAGATCACCTTCACAGGGGAGAGAGACTCGGA[A/T]GAGGTAAGCGGTTTTCTCCTGTCAATAGAAGYGGCTAAACATTGAGCGGG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: