zgc:92834

Ensembl ID:
ENSDARG00000035776
ZFIN ID:
ZDB-GENE-040718-206
Description:
N(6)-adenine-specific DNA methyltransferase 1 [Source:RefSeq peptide;Acc:NP_001002502]
Human Orthologue:
N6AMT1
Human Description:
N-6 adenine-specific DNA methyltransferase 1 (putative) [Source:HGNC Symbol;Acc:16021]
Mouse Orthologue:
N6amt1
Mouse Description:
N-6 adenine-specific DNA methyltransferase 1 (putative) Gene [Source:MGI Symbol;Acc:MGI:1915018]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38235 Nonsense Mutation detected in F1 DNA During 2018
sa9942 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38235
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051919 Nonsense 7 219 3 8
Genomic Location (Zv9):
Chromosome 1 (position 981482)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 970057
GRCz11 1 965236
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTTTTTCCCATCAGGCCTTGCTGTGGTGATGTTCCCGACTCCTCTGTA[T/G]GCTCCGGCCGGTCGCGGCCGCTTTTCGGAGGTGTATGAACCGGCCGAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9942
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051919 Nonsense 123 219 6 8
Genomic Location (Zv9):
Chromosome 1 (position 984678)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 973239
GRCz11 1 968418
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCCCAGGTTGAATGGAAAAGTGGATGTGCTTGTTTTCAATCCGCCGTA[T/A]GTGGYCACGCCKTCAGAAGAGGTAAACCAGTGCAAACACTCTCCTTTTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link