zgc:123190

Ensembl ID:
ENSDARG00000035770
ZFIN IDs:
ZDB-GENE-051030-48, ZDB-GENE-051030-48
Description:
ubiquitin-conjugating enzyme E2 C [Source:RefSeq peptide;Acc:NP_001032780]
Human Orthologue:
UBE2C
Human Description:
ubiquitin-conjugating enzyme E2C [Source:HGNC Symbol;Acc:15937]
Mouse Orthologue:
Ube2c
Mouse Description:
ubiquitin-conjugating enzyme E2C Gene [Source:MGI Symbol;Acc:MGI:1915862]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38583 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38583
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051906   None 171 None 7
ENSDART00000083679 Essential Splice Site 160 354 7 14
Genomic Location (Zv9):
Chromosome 6 (position 55279088)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 55295401
GRCz11 6 55305214
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAGCAAAACTCAAAGTAACTGAGCCAATAAAGCGAGAAGGACCGAAGG[T/A]ATTTATAATGTGCAATACGTTTAAAATGGAGAGAATAGCCAGTGCTGTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link