STX18

Ensembl ID:
ENSDARG00000035763
Description:
syntaxin 18 [Source:HGNC Symbol;Acc:15942]
Human Orthologue:
STX18
Human Description:
syntaxin 18 [Source:HGNC Symbol;Acc:15942]
Mouse Orthologue:
Stx18
Mouse Description:
syntaxin 18 Gene [Source:MGI Symbol;Acc:MGI:1918366]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35612 Nonsense Mutation detected in F1 DNA During 2018
sa22396 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa35612
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051893 Nonsense 32 315 1 11
Genomic Location (Zv9):
Chromosome 14 (position 161001)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 233897
GRCz11 14 20469
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGTCAAAACGCGGAATAAAGCGCTCGGGCTGATGGAGACTACCGGGAGA[G/T]AAGAACCGGGAGCCCAGAAGAGACCCAGACCGAGACAGAGGGACAGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22396
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051893 Essential Splice Site 147 315 5 11
Genomic Location (Zv9):
Chromosome 14 (position 157860)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 230759
GRCz11 14 23607
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATCTGTGTGTGTGTGTGATCAGTCCTCTTGATCAGTGATGTGCAGAGA[T/G]GAACAGTCCTTCACAATCTTCTGTTTACTGAAATCAAATGAGGATATCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link