gata4

Ensembl ID:
ENSDARG00000035759
ZFIN ID:
ZDB-GENE-980526-476
Description:
transcription factor GATA-4 [Source:RefSeq peptide;Acc:NP_571311]
Human Orthologue:
GATA4
Human Description:
GATA binding protein 4 [Source:HGNC Symbol;Acc:4173]
Mouse Orthologue:
Gata4
Mouse Description:
GATA binding protein 4 Gene [Source:MGI Symbol;Acc:MGI:95664]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45720 Nonsense Mutation detected in F1 DNA During 2018
sa44950 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45720
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049129 Nonsense 210 338 7 12
ENSDART00000099559 Nonsense 213 352 2 6
Genomic Location (Zv9):
Chromosome 20 (position 53591186)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 53151578
GRCz11 20 52956995
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTACCATAAGATGAACGGCATCAACCGGCCGCTGGTCAAACCACAGAGA[C/T]GACTGGTGAGAAAATTGCAATACTTTTTATTCTTAGTTGTTTTTATTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44950
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049129 Essential Splice Site 281 338 9 12
ENSDART00000099559 Essential Splice Site 284 352 4 6
Genomic Location (Zv9):
Chromosome 20 (position 53587386)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 53147778
GRCz11 20 52953195
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCAGACACGAAAGCGCAAACCCAAAAACATCAGCAAAACCAAACCCGG[T/G]GAGTGTCCTGTCTGCTGTCAGATATCCCCAACTGTTTATTGTAAACTGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link