zgc:152816

Ensembl ID:
ENSDARG00000035734
ZFIN ID:
ZDB-GENE-061110-40
Description:
hypothetical protein LOC777712 [Source:RefSeq peptide;Acc:NP_001071228]
Human Orthologue:
MATR3
Human Description:
matrin 3 [Source:HGNC Symbol;Acc:6912]
Mouse Orthologue:
Matr3
Mouse Description:
matrin 3 Gene [Source:MGI Symbol;Acc:MGI:1298379]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40602 Essential Splice Site Mutation detected in F1 DNA During 2018
sa40601 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40602
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051831 Essential Splice Site 216 904 None 22
ENSDART00000097267 Essential Splice Site 216 914 None 20
ENSDART00000114395 Essential Splice Site None 271 None 11
ENSDART00000132868   None 363 None 10
Genomic Location (Zv9):
Chromosome 5 (position 71129932)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 67162303
GRCz11 5 67840014
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCCCACATCCACCTCCCAAAAGACCCTACAGCTCCGACCCTTTCGCAGG[T/C]AAGCAATTTCCCTTCACATCAATTATTAATGATTATTTTTAGTTAATTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40601
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051831 Nonsense 365 904 7 22
ENSDART00000097267 Nonsense 372 914 8 20
ENSDART00000114395 Nonsense 150 271 8 11
ENSDART00000132868   None 363 None 10
Genomic Location (Zv9):
Chromosome 5 (position 71125991)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 67166244
GRCz11 5 67843955
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTGCATGCGTTTACAGCAGTGTTGTTTGTGTGCTTCCAGGCCTTGATC[G/T]AGATGGTTGACTGGCGTGATGCTGACATCATGGTGAAGTATTATTACAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link