utp6

Ensembl ID:
ENSDARG00000035730
ZFIN ID:
ZDB-GENE-040426-769
Description:
U3 small nucleolar RNA-associated protein 6 homolog [Source:RefSeq peptide;Acc:NP_001104677]
Human Orthologue:
UTP6
Human Description:
UTP6, small subunit (SSU) processome component, homolog (yeast) [Source:HGNC Symbol;Acc:18279]
Mouse Orthologue:
Utp6
Mouse Description:
UTP6, small subunit (SSU) processome component, homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:2445

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40668 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40668
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051818 Essential Splice Site 31 594 1 19
Genomic Location (Zv9):
Chromosome 6 (position 19379189)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 22059882
GRCz11 6 18531203
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGCTTGAACAACTGGAGAGAGTCGGTTTGTTTACCAATAAAGAAGTCAA[G/A]TGAGTATATCACTCGTGTTCATGCGAACAGAAAAGATGGATTGAAATGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link