zgc:101664

Ensembl ID:
ENSDARG00000035700
ZFIN ID:
ZDB-GENE-041010-187
Description:
hypothetical protein LOC450064 [Source:RefSeq peptide;Acc:NP_001006084]
Human Orthologue:
CTC-534A2.2
Human Description:
CDNA FLJ26957 fis, clone SLV00486 [Source:UniProtKB/TrEMBL;Acc:Q6ZNX1]
Mouse Orthologue:
2410002O22Rik
Mouse Description:
RIKEN cDNA 2410002O22 gene Gene [Source:MGI Symbol;Acc:MGI:1914225]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16791 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16791
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051777 Nonsense 77 205 2 3
Genomic Location (Zv9):
Chromosome 8 (position 585925)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 452705
GRCz11 8 534419
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACCGCTGATCCTGCCGGAGGAGCCKCTGCGTCAGGACCAAACGCAGAGC[C/T]RATCCAGAGCTGAGGGAMAGAGATTCCAACGSTCATGGTGTGCCATACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link