stm

Ensembl ID:
ENSDARG00000035694
ZFIN ID:
ZDB-GENE-031112-4
Description:
Protein starmaker [Source:UniProtKB/Swiss-Prot;Acc:A2VD23]
Human Orthologues:
AC010606.5, AC137896.1, AL008728.1, AL138918.1, DMP1
Human Description:
dentin matrix acidic phosphoprotein 1 [Source:HGNC Symbol;Acc:2932]
Mouse Orthologue:
Dmp1
Mouse Description:
dentin matrix protein 1 Gene [Source:MGI Symbol;Acc:MGI:94910]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15436 Essential Splice Site Available for shipment Available now
sa36758 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15436
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051768 Essential Splice Site 44 468 5 19
ENSDART00000074620 Essential Splice Site 44 212 5 15
ENSDART00000105174 Essential Splice Site 44 613 5 26
ENSDART00000110763 Essential Splice Site 33 231 4 16
ENSDART00000145710 Essential Splice Site 44 217 5 15
Genomic Location (Zv9):
Chromosome 19 (position 3726140)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 3222713
GRCz11 19 3163611
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TRAAGAGAAAAACAAACAAAGAATTAAACATGTTTTTCTCTTTYTTTTTC[A/G]GTTCAGTTTAATKTTGGTACTCCAGCGCCTGCAGATGGAGACTCAGGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36758
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051768 Essential Splice Site 83 468 7 19
ENSDART00000074620 Essential Splice Site 83 212 7 15
ENSDART00000105174 Essential Splice Site 83 613 7 26
ENSDART00000110763 Essential Splice Site 72 231 6 16
ENSDART00000145710 Essential Splice Site 83 217 7 15
Genomic Location (Zv9):
Chromosome 19 (position 3723736)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 3220309
GRCz11 19 3161207
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGTGCTTTTAGCTCCCGGTGACTCGTCTGACACCACTGAAAAACCAG[G/A]TCAGTGTCTGCTATCACCACTCATTCAGTCTAACATTCACAAAGACCTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link