
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
bmp8a
- Ensembl ID:
- ENSDARG00000035677
- ZFIN ID:
- ZDB-GENE-030912-13
- Description:
- bone morphogenetic protein 8A [Source:RefSeq peptide;Acc:NP_001038436]
- Human Orthologues:
- BMP8A, BMP8B
- Human Descriptions:
- bone morphogenetic protein 8a [Source:HGNC Symbol;Acc:21650]
- bone morphogenetic protein 8b [Source:HGNC Symbol;Acc:1075]
- Mouse Orthologues:
- Bmp8a, Bmp8b
- Mouse Descriptions:
- bone morphogenetic protein 8a Gene [Source:MGI Symbol;Acc:MGI:104515]
- bone morphogenetic protein 8b Gene [Source:MGI Symbol;Acc:MGI:107335]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa10778 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa10778
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000103253 | Nonsense | 278 | 433 | 4 | 7 |
- Genomic Location (Zv9):
- Chromosome 19 (position 36572020)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 35436540 GRCz11 19 35023660 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ATCACAGGTCWTGGGTGGGTCTGGTGGGTCGGCGTGGGCCTCGCTCTAAG[C/T]AGCCGTTCATGGTGACGTTCTTCAGAGCTAGTCAAGCCCCTTGCCGCCCA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: