zgc:101724

Ensembl ID:
ENSDARG00000035676
ZFIN ID:
ZDB-GENE-041114-111
Description:
hypothetical protein LOC334483 [Source:RefSeq peptide;Acc:NP_001019269]
Human Orthologue:
PTP4A2
Human Description:
protein tyrosine phosphatase type IVA, member 2 [Source:HGNC Symbol;Acc:9635]
Mouse Orthologue:
Ptp4a2
Mouse Description:
protein tyrosine phosphatase 4a2 Gene [Source:MGI Symbol;Acc:MGI:1277117]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23568 Essential Splice Site Available for shipment Available now
sa15070 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23568
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023709 Essential Splice Site 113 174 None 7
ENSDART00000051745 Essential Splice Site 107 168 None 6
ENSDART00000135838 Essential Splice Site 113 152 None 7

The following transcripts of ENSDARG00000035676 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 37013488)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 35878008
GRCz11 19 35465128
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGCCAGGATGCTGCATTGCCGTTCACTGTGTTGCAGGGTTGGGCCGG[T/A]GAGTCCTCAATGTGCTTCTTGAAACTATTTTTAAATAAGAGAAACTGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15070
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023709 Nonsense 174 174 7 7
ENSDART00000051745 Nonsense 168 168 6 6
ENSDART00000135838   None 152 None 7

The following transcripts of ENSDARG00000035676 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 37008204)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 35872724
GRCz11 19 35459844
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAAGATGCGTCTGAGGTTCAAGGAGGCCAACGGTCACAACTGCTGTATC[C/T]AGTAGTGCGTCATTCTGTCAGTCATACAAAACAGCAGTGGGAWGTTCAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link