zgc:114142

Ensembl ID:
ENSDARG00000035652
ZFIN ID:
ZDB-GENE-050913-41
Description:
diamine N-acetyltransferase 1 [Source:RefSeq peptide;Acc:NP_001025370]
Human Orthologue:
SAT1
Human Description:
spermidine/spermine N1-acetyltransferase 1 [Source:HGNC Symbol;Acc:10540]
Mouse Orthologue:
Sat1
Mouse Description:
spermidine/spermine N1-acetyl transferase 1 Gene [Source:MGI Symbol;Acc:MGI:98233]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20335 Nonsense Available for shipment Available now
sa33523 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa20335
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051699 Nonsense 95 171 4 6
ENSDART00000147691   None 88 5 7

The following transcripts of ENSDARG00000035652 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 4346425)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 4006094
GRCz11 5 4339129
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCACCTATGACCCCTGGATTGGGAAACTGCTCTACCTGGAAGATTTCTA[C/A]GTCATGAAGGAGTATCGGGGTATGAATGTGAGCTCGTCATTTTTAGATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33523
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051699 Essential Splice Site 102 171 None 6
ENSDART00000147691 Essential Splice Site None 88 None 7

The following transcripts of ENSDARG00000035652 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 4346525)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 4006194
GRCz11 5 4339229
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAGATTAGTGAGACACTGTAATGTAACACTTTTCTCTCAACACAAATT[A/C]GGTTTCGGGATTGGGTCTGAAATCCTGAAGAAACTCAGTCAGGTGAGTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link