irx4a

Ensembl ID:
ENSDARG00000035648
ZFIN ID:
ZDB-GENE-040426-1825
Description:
iroquois-class homeodomain protein IRX-4 [Source:RefSeq peptide;Acc:NP_991261]
Human Orthologue:
IRX4
Human Description:
iroquois homeobox 4 [Source:HGNC Symbol;Acc:6129]
Mouse Orthologue:
Irx4
Mouse Description:
Iroquois related homeobox 4 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1355275]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17778 Nonsense Available for shipment Available now
sa17695 Nonsense Available for shipment Available now
sa45557 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa17778
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051693 Nonsense 126 440 3 5
ENSDART00000051693 Nonsense 126 440 3 5
Genomic Location (Zv9):
Chromosome 16 (position 279615)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 290131
GRCz11 16 381459
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGGGWTAACACCGGCTGCCRCATATTACCCATACGATCCCACCCTGGGA[C/T]AGTACCAGTATGACAGGTATTGAAMWKCGGCCATCATAAGAGTCTTCTGW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17695
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051693 Nonsense 126 440 3 5
ENSDART00000051693 Nonsense 126 440 3 5
Genomic Location (Zv9):
Chromosome 16 (position 279615)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 290131
GRCz11 16 381459
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGGGWTAACACCGGCTGCCRCATATTACCCATACGATCCCACCCTGGGA[C/T]AGTACCAGTATGACAGGTATTGAAMWKCGGCCATCATAAGAGTCTTCTGW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45557
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051693 Nonsense 194 440 4 5
Genomic Location (Zv9):
Chromosome 16 (position 280213)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 289533
GRCz11 16 380861
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAGATGACCCTCACTCAGGTGTCCACCTGGTTCGCCAACGCCAGAAGG[A/T]GACTCAAGAAGGAGAACAAGATGACCTGGCCACCGAGGAACAAGGGCTCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link