zgc:194112

Ensembl ID:
ENSDARG00000035632
ZFIN ID:
ZDB-GENE-081022-55
Description:
C-C motif chemokine 19-like [Source:RefSeq peptide;Acc:NP_001129720]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12579 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12579
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051668 Essential Splice Site None 96 4 4
Genomic Location (Zv9):
Chromosome 5 (position 14578510)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 12875947
GRCz11 5 13376164
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GWCCCCTGATAAGAATAATGTAAWCTAGTTTCGTTTTTCTGCTGTTTTTC[A/T]GACGAGAAGTGAACAAGATGACCCCGCAGCTGCACTTAACAAACAGGAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link