xbp1

Ensembl ID:
ENSDARG00000035622
ZFIN ID:
ZDB-GENE-011210-2
Description:
X-box-binding protein 1 [Source:RefSeq peptide;Acc:NP_571949]
Human Orthologue:
XBP1
Human Description:
X-box binding protein 1 [Source:HGNC Symbol;Acc:12801]
Mouse Orthologue:
Xbp1
Mouse Description:
X-box binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:98970]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40380 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40380
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051649 Nonsense 298 383 6 6
ENSDART00000124467   None 263 5 5

The following transcripts of ENSDARG00000035622 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 17718867)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 15444827
GRCz11 5 15945044
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGATTCCGTCGCCTTCTCTGAAACCGAGGAAGAAATCCAGGTGGAGGAT[C/T]AAACGGTTTCTGTCAAGGACGAACCGGAGGAAGTGGTCATCCCTGCGGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link