zgc:113208

Ensembl ID:
ENSDARG00000035610
ZFIN ID:
ZDB-GENE-050417-450
Description:
hypothetical protein LOC550591 [Source:RefSeq peptide;Acc:NP_001017892]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40409 Essential Splice Site Mutation detected in F1 DNA During 2018
sa8818 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40409
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051623   None 285 None 6
ENSDART00000138716 Essential Splice Site None 207 1 6
ENSDART00000146035   None 148 None 5
Genomic Location (Zv9):
Chromosome 5 (position 24404711)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 22117583
GRCz11 5 22621383
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATTGGCGGCGGTAGTCAAGGCAAAACTGTTTATGTAGTTTGATTGTGT[G/A]TTACGTGTAGGCTTGGGCGGTATCCAAATTTTGAGACCGTCAAACCGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8818
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051623 Nonsense 261 285 6 6
ENSDART00000138716   None 207 None 6
ENSDART00000146035   None 148 None 5
Genomic Location (Zv9):
Chromosome 5 (position 24389772)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 22102644
GRCz11 5 22606444
KASP Assay ID:
2259-5698.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCGGTCCGGTTGTGCTTACGACAACGTTACTGTTTCCCCAGTGGTCAGA[C/T]AGACTCTACAGCACTGGGGGTACAAACTCACSCCGGAGGACTACAAGCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link