
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
mtnr1c
- Ensembl ID:
- ENSDARG00000035609
- ZFIN ID:
- ZDB-GENE-990415-158
- Description:
- Melatonin receptor type 1C [Source:UniProtKB/Swiss-Prot;Acc:P51052]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa20390 | Nonsense | Available for shipment | Available now |
sa9234 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa20390
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000051622 | Nonsense | 191 | 361 | 2 | 2 |
ENSDART00000121608 | Nonsense | 142 | 304 | 3 | 3 |
ENSDART00000128781 | Nonsense | 191 | 361 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 5 (position 24448671)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 22161543 GRCz11 5 22665343 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GACCCGCGGGTTTTCTCCTGCACCTTCACCCAGACAGCGAGCTCTTCTTA[T/G]ACAGTCTGTGTTGTTCTGATCCACTTCCTTGTCCCGTTGGGTGTGGTTTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9234
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000051622 | Nonsense | 236 | 361 | 2 | 2 |
ENSDART00000121608 | Nonsense | 187 | 304 | 3 | 3 |
ENSDART00000128781 | Nonsense | 236 | 361 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 5 (position 24448805)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 22161677 GRCz11 5 22665477 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- YAGGGTTAAAGGACGCGTGCGGCCCAATCCAAAAGTCAGAGCGGCTGATT[T/A]GAGGAATTTCCTGACAATGTTTGTGGTGTTTGTGCTATTCGCYGTGTGCT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: