
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
tchp
- Ensembl ID:
- ENSDARG00000035605
- ZFIN ID:
- ZDB-GENE-060421-3368
- Description:
- Trichoplein keratin filament-binding protein [Source:UniProtKB/Swiss-Prot;Acc:Q1RM03]
- Human Orthologue:
- TCHP
- Human Description:
- trichoplein, keratin filament binding [Source:HGNC Symbol;Acc:28135]
- Mouse Orthologue:
- Tchp
- Mouse Description:
- trichoplein, keratin filament binding Gene [Source:MGI Symbol;Acc:MGI:1925082]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa31424 | Splice Site, Nonsense | Available for shipment | Available now |
sa26437 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa33566 | Essential Splice Site | Available for shipment | Available now |
sa14422 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa31424
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Splice Site, Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000051614 | Splice Site, Nonsense | 176 | 499 | 4 | 12 |
- Genomic Location (Zv9):
- Chromosome 5 (position 21655373)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 19368245 GRCz11 5 19872045 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACAAAGATCACATTGTGAGTCAGTGGCAGGTTCAACAGCAAGAGAAAAAA[C/T]AGGTAAGACATGTTAAATGTCGGCACAAGCATGAATGCAACTCGGCTGCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa26437
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000051614 | Essential Splice Site | 272 | 499 | 6 | 12 |
- Genomic Location (Zv9):
- Chromosome 5 (position 21656396)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 19369268 GRCz11 5 19873068 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGGATGAGAGGAAGATGATGGAGGAAAGCAGAAGGAAAACGGAATTTGGG[T/C]GAAAAATTTAGACTTAAATATTGTATGTGTTAAGGGATTTATTTCTTTAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa33566
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000051614 | Essential Splice Site | 380 | 499 | 10 | 12 |
- Genomic Location (Zv9):
- Chromosome 5 (position 21659265)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 19372137 GRCz11 5 19875937 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATTAAATGTAGTCAAATTTGTGACCGTTAGTTTGTGTGATATTTTTTGTC[A/G]GGTCCTGGCAGGTCGTCAGCAGCAGTTGCAGGAGCGAATGCAGGAAAACA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14422
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000051614 | Nonsense | 480 | 499 | 11 | 12 |
- Genomic Location (Zv9):
- Chromosome 5 (position 21662134)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 19375006 GRCz11 5 19878806 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGAGGGAGGAGCTTAGGCTCCAGGAGGAGGAACTTCGTCTTGAGACGGAC[C/T]GAATGATTCGACAGGGCTTYCAGGAGAGAGTGAGTGGAGATTAAKGTGCT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Metabolite levels (MHPG): Genome-wide association study of monoamine metabolite levels in human cerebrospinal fluid. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: