
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
dgcr8
- Ensembl ID:
- ENSDARG00000035564
- ZFIN ID:
- ZDB-GENE-030131-3421
- Description:
- microprocessor complex subunit DGCR8 [Source:RefSeq peptide;Acc:NP_001116221]
- Human Orthologue:
- DGCR8
- Human Description:
- DiGeorge syndrome critical region gene 8 [Source:HGNC Symbol;Acc:2847]
- Mouse Orthologue:
- Dgcr8
- Mouse Description:
- DiGeorge syndrome critical region gene 8 Gene [Source:MGI Symbol;Acc:MGI:2151114]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa223 | Nonsense | F2 line generated | During 2018 |
sa40420 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa223
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000051554 | Nonsense | 352 | 765 | 4 | 14 |
ENSDART00000124915 | Nonsense | 352 | 782 | 4 | 13 |
ENSDART00000144560 | Nonsense | 352 | 782 | 5 | 14 |
- Genomic Location (Zv9):
- Chromosome 5 (position 26193854)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 24021119 GRCz11 5 24524919 - KASP Assay ID:
- 554-0125.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACCCACCAACCAGTAGCATTCCCTGCCTGCACTACAAGAAAATGAAGGAA[C/T]AAGAAGAAAGGGAACAGAATGGAGAGGTGACTCCGACAGCGGAGATTTCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa40420
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000051554 | Essential Splice Site | 561 | 765 | 8 | 14 |
ENSDART00000124915 | Essential Splice Site | 578 | 782 | 7 | 13 |
ENSDART00000144560 | Essential Splice Site | 578 | 782 | 8 | 14 |
- Genomic Location (Zv9):
- Chromosome 5 (position 26195479)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 24022744 GRCz11 5 24526544 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TACGGCACTGGAACAGCTAGTAGTAAAAAACTTGCCAAGAATAAAGCTGG[T/A]ATCTTTTCCCCGTTTCTGTTTGAGTCCTGTAATCTCAGCAAGAAATCATT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: