znf703

Ensembl ID:
ENSDARG00000035563
ZFIN ID:
ZDB-GENE-010717-1
Description:
Zinc finger protein 703 [Source:UniProtKB/Swiss-Prot;Acc:Q90ZE2]
Human Orthologue:
ZNF703
Human Description:
zinc finger protein 703 [Source:HGNC Symbol;Acc:25883]
Mouse Orthologue:
Zfp703
Mouse Description:
zinc finger protein 703 Gene [Source:MGI Symbol;Acc:MGI:2662729]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7563 Missense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa7563
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051553 Missense 379 589 2 2
Genomic Location (Zv9):
Chromosome 5 (position 26000330)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23827595
GRCz11 5 24331395
KASP Assay ID:
554-4155.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCAGGAAAGCACCCCAGCTCCAGTCCTCTCACAGGGGCCTCACCTCCCT[C/A]TTTCATGCAGGGCTTGTGCAGGGACCCATATTGCCTGACCTACCCCAATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Breast size: Genetic variants associated with breast size also influence breast cancer risk. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link