
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
rps6ka3a
- Ensembl ID:
- ENSDARG00000035556
- ZFIN ID:
- ZDB-GENE-030219-119
- Description:
- ribosomal protein S6 kinase alpha-1 [Source:RefSeq peptide;Acc:NP_997951]
- Human Orthologues:
- RPS6KA3, RPS6KA6
- Human Descriptions:
- ribosomal protein S6 kinase, 90kDa, polypeptide 3 [Source:HGNC Symbol;Acc:10432]
- ribosomal protein S6 kinase, 90kDa, polypeptide 6 [Source:HGNC Symbol;Acc:10435]
- Mouse Orthologues:
- Rps6ka3, Rps6ka6
- Mouse Descriptions:
- ribosomal protein S6 kinase polypeptide 3 Gene [Source:MGI Symbol;Acc:MGI:104557]
- ribosomal protein S6 kinase polypeptide 6 Gene [Source:MGI Symbol;Acc:MGI:1914321]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa10515 | Nonsense | Available for shipment | Available now |
sa40417 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa14662 | Nonsense | Available for shipment | Available now |
sa6974 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa10515
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000051546 | Nonsense | 101 | 732 | 5 | 22 |
- Genomic Location (Zv9):
- Chromosome 5 (position 25687339)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 23514604 GRCz11 5 24018404 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AAATTTAAGCGTGTTATTGTTYGTTTACAATCTGGTTTGTGGTTTCAGTG[C/T]GAGATCGAGTGCGTACAAAAATGGAGAGGGACATTCTTGTTGAGGTCAAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa40417
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000051546 | Essential Splice Site | 189 | 732 | 8 | 22 |
- Genomic Location (Zv9):
- Chromosome 5 (position 25685728)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 23512993 GRCz11 5 24016793 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAGCGCAGTGCACATTTTAATAAGTGCTCAATTTCTTGATTTCTTTTACA[G/A]TATTCTCTTGGATGATGATGGACACATCAAACTTACAGGTATGTGTGCTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14662
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000051546 | Nonsense | 500 | 732 | 17 | 22 |
- Genomic Location (Zv9):
- Chromosome 5 (position 25682445)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 23509710 GRCz11 5 24013510 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGGTCACAGAGTTGATGAAAGGTGGAGAACTACTGGATAAAATCCTCCGA[C/T]AAAARTTTTTCTCTGAGAGAGAAGCAAGCGCTGTCCTCTACACCATWACA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa6974
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000051546 | Nonsense | 684 | 732 | 21 | 22 |
- Genomic Location (Zv9):
- Chromosome 5 (position 25680703)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 23507968 GRCz11 5 24011768 - KASP Assay ID:
- 554-5278.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GCCATYCATGGATAATCAACAAGGACCAGTTACCCAAATACCAACTCAAT[C/T]GACAGGATGCTCCTCACCTAGTGAAGGTTTGCTTTGCTRTAATGGWCTCA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: