zgc:110329

Ensembl ID:
ENSDARG00000035532
ZFIN ID:
ZDB-GENE-050417-334
Description:
hypothetical protein LOC550500 [Source:RefSeq peptide;Acc:NP_001017802]
Human Orthologue:
TSPAN15
Human Description:
tetraspanin 15 [Source:HGNC Symbol;Acc:23298]
Mouse Orthologue:
Tspan15
Mouse Description:
tetraspanin 15 Gene [Source:MGI Symbol;Acc:MGI:1917673]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45207 Nonsense Mutation detected in F1 DNA During 2018
sa44607 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45207
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051515 Nonsense 151 346 5 8
Genomic Location (Zv9):
Chromosome 5 (position 29786722)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 27542020
GRCz11 5 28142173
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGTCCCATGCTTTAACATGCTTTCTGTTTGACCTGTCCAGTTTTCTTG[T/A]TGTGGAGGAGACGAGTACAAGGATTGGGAAGTAAACCAGTACCACCTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44607
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051515 Nonsense 277 346 8 8
Genomic Location (Zv9):
Chromosome 5 (position 29780073)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 27535371
GRCz11 5 28135524
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCGAGTCTCAAGACATGGTGGACTTTAAGTTCCTGAAACGTGCTGGTTA[T/G]AAGTACAGCGAGCTGGACCTTTCAGGTGCCGGATGGTGTATGTGTTTACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link