LOC100334679

Ensembl ID:
ENSDARG00000035530

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa26485 Nonsense Mutation detected in F1 DNA During 2018
sa26486 Nonsense Mutation detected in F1 DNA During 2018
sa33615 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa26485
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051505 Nonsense 121 293 1 1
Genomic Location (Zv9):
Chromosome 5 (position 30067540)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 27822838
GRCz11 5 28422991
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCTTTCTGTTACTTTGTTGAGTGTGCAAAGGTACCTGCAGGTGCTTTA[T/A]CCACAGCGATGGGCGAAGCTTGGACAGAAGGGCCAAAAAGGGCTGATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26486
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051505 Nonsense 153 293 1 1
Genomic Location (Zv9):
Chromosome 5 (position 30067636)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 27822934
GRCz11 5 28423087
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTTTGGCATTTGGACTTTAGGTGGAACTTTGGCTTCTTATGCTCTTTA[C/A]TTCAGAAATGTCAAGTTGAAGAAGGATGGGCTGCTACACTGTTATCAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33615
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051505 Nonsense 197 293 1 1
Genomic Location (Zv9):
Chromosome 5 (position 30067767)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 27823065
GRCz11 5 28423218
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGCTTTTTGAGAATCTGGTGATGTTTGTTTTGCCTCTCTGCAGCCTGT[T/A]AAGCTTCTACTTTCAACTTCACCGACGGATAAATCAATCAGCTTCTTTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link