zgc:92201

Ensembl ID:
ENSDARG00000035515
ZFIN ID:
ZDB-GENE-040718-387
Description:
TM2 domain-containing protein 2 [Source:UniProtKB/Swiss-Prot;Acc:Q6DHN3]
Human Orthologue:
TM2D2
Human Description:
TM2 domain containing 2 [Source:HGNC Symbol;Acc:24127]
Mouse Orthologue:
Tm2d2
Mouse Description:
TM2 domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1916992]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31440 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31440
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051483 Nonsense 33 229 1 4
Genomic Location (Zv9):
Chromosome 5 (position 28565900)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 26321198
GRCz11 5 26921351
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTGTTTTTTACAGTGCTGCTTTTACAGTGTCTAGAAGGGATTCACTCA[C/T]AAAACTCAACCGAGCCACCCGGAAACAGGGTAACGACTAGCAAACCAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link