spns3

Ensembl ID:
ENSDARG00000035459
ZFIN ID:
ZDB-GENE-060531-7
Description:
Protein spinster homolog 3 [Source:UniProtKB/Swiss-Prot;Acc:A2CER7]
Human Orthologue:
SPNS3
Human Description:
spinster homolog 3 (Drosophila) [Source:HGNC Symbol;Acc:28433]
Mouse Orthologue:
Spns3
Mouse Description:
spinster homolog 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1924827]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9844 Nonsense Available for shipment Available now
sa18804 Nonsense Mutation detected in F1 DNA During 2018
sa40468 Essential Splice Site Mutation detected in F1 DNA During 2018
sa40467 Essential Splice Site, Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa9844
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051392 Nonsense 135 500 3 12
ENSDART00000127787 Nonsense 135 498 3 12
ENSDART00000051392 Nonsense 135 500 3 12
ENSDART00000127787 Nonsense 135 498 3 12
Genomic Location (Zv9):
Chromosome 5 (position 32612753)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 30373583
GRCz11 5 30973736
KASP Assay ID:
2259-5995.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGTTGGGCTGGTTATGTGGATCGTCACAACACTGGSAAGCTCTTTCGTC[A/T]GAAAATCGGTACAGTACAAAGTCTCACAGCTTCGATAACGTGTATATGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18804
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051392 Nonsense 135 500 3 12
ENSDART00000127787 Nonsense 135 498 3 12
ENSDART00000051392 Nonsense 135 500 3 12
ENSDART00000127787 Nonsense 135 498 3 12
Genomic Location (Zv9):
Chromosome 5 (position 32612753)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 30373583
GRCz11 5 30973736
KASP Assay ID:
2259-5995.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGTTGGGCTGGTTATGTGGATCGTCACAACACTGGGAAGCTCTTTCGTC[A/T]GAAAATCGGTACAGTACAAAGTCTCACAGCTTCGATAACGTGTATATGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40468
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051392 Essential Splice Site 137 500 3 12
ENSDART00000127787 Essential Splice Site 137 498 3 12
Genomic Location (Zv9):
Chromosome 5 (position 32612744)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 30373574
GRCz11 5 30973727
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTTATGTGGATCGTCACAACACTGGGAAGCTCTTTCGTCAGAAAATCG[G/A]TACAGTACAAAGTCTCACAGCTTCGATAACGTGTATATGATTTATATTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40467
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051392 Essential Splice Site 308 500 8 12
ENSDART00000127787 Splice Site None 498 None 12
Genomic Location (Zv9):
Chromosome 5 (position 32604969)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 30365799
GRCz11 5 30965952
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAGTGGGGCTGAAATTGAATAACATCACATTGTTTCTTCTTTCTTTCA[T/C]GCGTAAGCTACATTTTTGGAGCAATCACAGTGGTGACAGGGGTTGTGGGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link