
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
atp2a1l
- Ensembl ID:
- ENSDARG00000035458
- ZFIN ID:
- ZDB-GENE-041229-2
- Description:
- ATPase, Ca++ transporting, cardiac muscle, fast twitch 1 like [Source:RefSeq peptide;Acc:NP_0010710
- Human Orthologue:
- ATP2A1
- Human Description:
- ATPase, Ca++ transporting, cardiac muscle, fast twitch 1 [Source:HGNC Symbol;Acc:811]
- Mouse Orthologue:
- Atp2a1
- Mouse Description:
- ATPase, Ca++ transporting, cardiac muscle, fast twitch 1 Gene [Source:MGI Symbol;Acc:MGI:105058]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa1409 | Nonsense | Available for shipment | Available now |
sa45455 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa14828 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa22052 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa1409
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000105896 | Nonsense | 407 | 991 | 11 | 24 |
ENSDART00000144542 | Nonsense | 334 | 918 | 8 | 21 |
- Genomic Location (Zv9):
- Chromosome 12 (position 14359511)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 13215164 GRCz11 12 13253467 - KASP Assay ID:
- 554-1330.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TATCATTTCTTCAGCACAAAGYTGGGTGCCAAAGTTGACTGCAGTCAATA[T/A]GAYGGTTTAGTTGAGTTGGCCACCATCTGCGCCCTGTGCAAYGATTCCTC
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Mutation Details
- Allele Name:
- sa45455
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000105896 | Essential Splice Site | 429 | 991 | 11 | 24 |
ENSDART00000144542 | Essential Splice Site | 356 | 918 | 8 | 21 |
- Genomic Location (Zv9):
- Chromosome 12 (position 14359578)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 13215231 GRCz11 12 13253534 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGGCCACCATCTGCGCCCTGTGCAATGATTCCTCCCTTGACTACAATGAG[G/A]TGAGAGATGTTCTTTCAAACTTCTATCGAAAGCTTTTATCCATATATGTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14828
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000105896 | Nonsense | 829 | 991 | 18 | 24 |
ENSDART00000144542 | Nonsense | 756 | 918 | 15 | 21 |
- Genomic Location (Zv9):
- Chromosome 12 (position 14362596)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 13218249 GRCz11 12 13256552 - KASP Assay ID:
- 1641-0489.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ATCATGGGCAAACCTCCCCGCTCYCCCAAAGARCCCCTGATTTCTGGCTG[G/A]TTGTTCTTCAGATACATGACCGTTGGTGGTAGGTGTRCTTGTTANTTTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22052
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000105896 | Essential Splice Site | 838 | 991 | 18 | 24 |
ENSDART00000144542 | Essential Splice Site | 765 | 918 | 15 | 21 |
- Genomic Location (Zv9):
- Chromosome 12 (position 14362625)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 13218278 GRCz11 12 13256581 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGAACCCCTGATTTCTGGCTGGTTGTTCTTCAGATACATGACCGTTGGTG[G/A]TAGGTGTACTTGTTATTTTTTGTGGAATATCTTTAGTAACATTCTCTTTG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Weight: Genome-wide association yields new sequence variants at seven loci that associate with measures of obesity. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: