
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
myhc4
- Ensembl ID:
- ENSDARG00000035438
- ZFIN ID:
- ZDB-GENE-030131-6206
- Description:
- myosin heavy chain 4 [Source:RefSeq peptide;Acc:NP_001018321]
- Human Orthologues:
- MYH6, MYH7
- Human Descriptions:
- myosin, heavy chain 6, cardiac muscle, alpha [Source:HGNC Symbol;Acc:7576]
- myosin, heavy chain 7, cardiac muscle, beta [Source:HGNC Symbol;Acc:7577]
- Mouse Orthologues:
- Myh6, Myh7
- Mouse Descriptions:
- myosin, heavy polypeptide 6, cardiac muscle, alpha Gene [Source:MGI Symbol;Acc:MGI:97255]
- myosin, heavy polypeptide 7, cardiac muscle, beta Gene [Source:MGI Symbol;Acc:MGI:2155600]
Alleles
There are 6 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa9273 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa44609 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa31457 | Nonsense | Available for shipment | Available now |
sa20460 | Nonsense | Available for shipment | Available now |
sa20461 | Nonsense | Available for shipment | Available now |
sa31458 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa9273
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000051362 | Essential Splice Site | 69 | 1937 | 2 | 40 |
ENSDART00000077471 | None | 105 | None | 4 | |
ENSDART00000125917 | Essential Splice Site | 69 | 1935 | 3 | 41 |
ENSDART00000131133 | Essential Splice Site | 69 | 1078 | 3 | 25 |
- Genomic Location (Zv9):
- Chromosome 5 (position 33860125)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 31622357 GRCz11 5 32222510 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGAGCAAAGACGGTGGCAAAGTCACCGTTATTACGCTTGACACTAAGGAG[G/A]TGAATTTTTACCCTTTGCATAAATGAATCAAAATTACAAAGCCTTTMTAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa44609
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000051362 | Nonsense | 405 | 1937 | 12 | 40 |
ENSDART00000077471 | None | 105 | None | 4 | |
ENSDART00000125917 | Nonsense | 405 | 1935 | 13 | 41 |
ENSDART00000131133 | Nonsense | 405 | 1078 | 13 | 25 |
- Genomic Location (Zv9):
- Chromosome 5 (position 33863595)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 31625827 GRCz11 5 32225980 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTTACCTATTGGGTTTGAACTCTGCTGAATTGCTGAAGGCTTTGTGCTA[C/A]CCCAGAGTCAAGGTCGGAAATGAGTTTGTGACCAAAGGCCAGACTGTGCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa31457
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000051362 | Nonsense | 661 | 1937 | 17 | 40 |
ENSDART00000077471 | None | 105 | None | 4 | |
ENSDART00000125917 | Nonsense | 659 | 1935 | 18 | 41 |
ENSDART00000131133 | Nonsense | 659 | 1078 | 18 | 25 |
- Genomic Location (Zv9):
- Chromosome 5 (position 33864879)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 31627111 GRCz11 5 32227264 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATGTGAATACAAATCAGAAACTTTTCATGACTAAACAGGAGAACTTGGGC[A/T]AGCTTATGACCAACTTGAGGAGCACTCACCCTCACTTTGTGCGTTGTCTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa20460
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000051362 | Nonsense | 723 | 1937 | 18 | 40 |
ENSDART00000077471 | None | 105 | None | 4 | |
ENSDART00000125917 | Nonsense | 721 | 1935 | 19 | 41 |
ENSDART00000131133 | Nonsense | 721 | 1078 | 19 | 25 |
- Genomic Location (Zv9):
- Chromosome 5 (position 33865176)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 31627408 GRCz11 5 32227561 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCAGAATCTGCAGAAAGGGTTTCCCCAGCAGAATCCTCTATGGTGACTTC[A/T]AGCAGAGGTAAATGGGACTTTATATAAACATGTAATTTATTTACTGTAAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa20461
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000051362 | Nonsense | 744 | 1937 | 19 | 40 |
ENSDART00000077471 | None | 105 | None | 4 | |
ENSDART00000125917 | Nonsense | 742 | 1935 | 20 | 41 |
ENSDART00000131133 | Nonsense | 742 | 1078 | 20 | 25 |
- Genomic Location (Zv9):
- Chromosome 5 (position 33865328)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 31627560 GRCz11 5 32227713 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGGTGTTGAATGCCAGTGTTATCCCAGAGGGACAGTTCATTGACAACAAG[A/T]AGGCCAGTGAGAAACTCCTGGGATCTATTGATGTTAATCATGATGAGTAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa31458
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000051362 | Essential Splice Site | 812 | 1937 | 21 | 40 |
ENSDART00000077471 | None | 105 | None | 4 | |
ENSDART00000125917 | Essential Splice Site | 810 | 1935 | 22 | 41 |
ENSDART00000131133 | Essential Splice Site | 810 | 1078 | 22 | 25 |
- Genomic Location (Zv9):
- Chromosome 5 (position 33865709)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 31627941 GRCz11 5 32228094 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGTGAATGGTAAAAAGTAATGATTATGGCATTTAATGATGAACTATTCAC[A/T]GGGAGTCCATTTACACCATCCAGTACAACATCCGCTCATTCATGAATGTC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Electrocardiographic traits: Several common variants modulate heart rate, PR interval and QRS duration. (View Study)
- Resting heart rate: Common genetic variation near the connexin-43 gene is associated with resting heart rate in African Americans: a genome-wide association study of 13,372 participants. (View Study)
- Resting heart rate: Genome-wide association analysis identifies multiple loci related to resting heart rate. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
OMIM
- Atrial septal defect 3
- Cardiomyopathy, dilated, 1EE
- Cardiomyopathy, familial hypertrophic, 14
- Sick sinus syndrome 3
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: