wu:fd14a01

Ensembl ID:
ENSDARG00000035437
ZFIN ID:
ZDB-GENE-030131-5336
Human Orthologues:
MYH6, MYH7
Human Descriptions:
myosin, heavy chain 6, cardiac muscle, alpha [Source:HGNC Symbol;Acc:7576]
myosin, heavy chain 7, cardiac muscle, beta [Source:HGNC Symbol;Acc:7577]
Mouse Orthologues:
Myh6, Myh7
Mouse Descriptions:
myosin, heavy polypeptide 6, cardiac muscle, alpha Gene [Source:MGI Symbol;Acc:MGI:97255]
myosin, heavy polypeptide 7, cardiac muscle, beta Gene [Source:MGI Symbol;Acc:MGI:2155600]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37392 Splice Site, Nonsense Available for shipment Available now
sa24042 Nonsense Available for shipment Available now
sa29676 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37392
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051360 Splice Site, Nonsense 269 1936 8 39
Genomic Location (Zv9):
Chromosome 22 (position 284509)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 293593
GRCz11 22 280714
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTTAATCAAGACTAGTCCATGTCTTACTATGTTTTTTTCTTTGAAAGA[C/A]CTGCTGGAAAAGTCAAGAGTAACATTCCAGCTGTCTGCTGAGAGGAGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24042
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051360 Nonsense 1615 1936 32 39
Genomic Location (Zv9):
Chromosome 22 (position 293430)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 284672
GRCz11 22 271793
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATGCAGAGCACTCTGGACTCTGAGGTCAGGAGCAGAAATGATGCCCTG[A/T]GAGTCAAAAAGAAGATGGAGGGAGATCTGAATGAGATGGAGATCCAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29676
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051360 Essential Splice Site 1763 1936 34 39
Genomic Location (Zv9):
Chromosome 22 (position 295983)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 282119
GRCz11 22 269240
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGGAGGCCAGAAACGCAGAGGAGAAGGCCAAGAAGGCCATCACTGAT[G/A]TGAGTGTTTACATTCTGTTGCTCTATTCTCTCGTAAACTCTTTTACTGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link