zmat5

Ensembl ID:
ENSDARG00000035434
ZFIN ID:
ZDB-GENE-040808-31
Description:
Zinc finger matrin-type protein 5 [Source:UniProtKB/Swiss-Prot;Acc:Q6AXL8]
Human Orthologue:
ZMAT5
Human Description:
zinc finger, matrin-type 5 [Source:HGNC Symbol;Acc:28046]
Mouse Orthologue:
Zmat5
Mouse Description:
zinc finger, matrin type 5 Gene [Source:MGI Symbol;Acc:MGI:1914428]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12097 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12097
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051357 Nonsense 145 173 5 5
ENSDART00000144510 Nonsense 153 181 5 5
Genomic Location (Zv9):
Chromosome 5 (position 33717497)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31479729
GRCz11 5 32079882
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAAGGATGGAAGAGGAAGAATGCACAGAAAACATTGAGATACCTCCTTA[T/A]TTGCTATCTATTCCAGATCTTCCTCCATCTCTCCATCCTCCACCTGCTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link